non targeting nt control sgrna (Addgene inc)
Addgene inc is a verified supplier 
96
Structured Review
Addgene inc
non targeting nt control sgrna
Non Targeting Nt Control Sgrna, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 6181 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/non+targeting+control+sgrna/lentiCRISPR+v2+(Plasmid+%2352961)/pm41840739-171-12-20
Average 96 stars, based on 6181 article reviews
Non Targeting Nt Control Sgrna, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 6181 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/non+targeting+control+sgrna/lentiCRISPR+v2+(Plasmid+%2352961)/pm41840739-171-12-20
Average 96 stars, based on 6181 article reviews
non targeting nt control sgrna - by Bioz Stars,
2026-10
96/100 stars
Images
Related Articles
Knockdown:Article Title: KSR1- and ERK-dependent Translational Regulation of the Epithelial-to-Mesenchymal Transition Article Snippet: .. The KSR1 knockdown was confirmed via Western Blotting. pCAG-SpCas9-GFP-U6-gRNA was a gift from Jizhong Zou (Addgene plasmid #79144), KSR1 sgRNA and Article Title: OVOL2 impairs RHO GTPase signaling to restrain mitosis and aggressiveness of Anaplastic Thyroid Cancer Article Snippet: .. For OVOL2 CRISPR-interference (CRISPRi) knockdown two sgRNAs (sg1: CACCGTCGCGAGTGAGACCACGCCG, sg2: CACCGTTGACACCGTTATGTTGCA) targeting the OVOL2 promoter and a Article Title: KSR1- and ERK-dependent translational regulation of the epithelial-to-mesenchymal transition Article Snippet: .. The KSR1 knockdown was confirmed via western blotting. pCAG-SpCas9-GFP-U6-gRNA was a gift from Jizhong Zou (Addgene plasmid #79144), KSR1 sgRNA and Western Blot:Article Title: KSR1- and ERK-dependent Translational Regulation of the Epithelial-to-Mesenchymal Transition Article Snippet: .. The KSR1 knockdown was confirmed via Western Blotting. pCAG-SpCas9-GFP-U6-gRNA was a gift from Jizhong Zou (Addgene plasmid #79144), KSR1 sgRNA and Article Title: KSR1- and ERK-dependent translational regulation of the epithelial-to-mesenchymal transition Article Snippet: .. The KSR1 knockdown was confirmed via western blotting. pCAG-SpCas9-GFP-U6-gRNA was a gift from Jizhong Zou (Addgene plasmid #79144), KSR1 sgRNA and Plasmid Preparation:Article Title: KSR1- and ERK-dependent Translational Regulation of the Epithelial-to-Mesenchymal Transition Article Snippet: .. The KSR1 knockdown was confirmed via Western Blotting. pCAG-SpCas9-GFP-U6-gRNA was a gift from Jizhong Zou (Addgene plasmid #79144), KSR1 sgRNA and Article Title: OVOL2 impairs RHO GTPase signaling to restrain mitosis and aggressiveness of Anaplastic Thyroid Cancer Article Snippet: .. For OVOL2 CRISPR-interference (CRISPRi) knockdown two sgRNAs (sg1: CACCGTCGCGAGTGAGACCACGCCG, sg2: CACCGTTGACACCGTTATGTTGCA) targeting the OVOL2 promoter and a Article Title: KSR1- and ERK-dependent translational regulation of the epithelial-to-mesenchymal transition Article Snippet: .. The KSR1 knockdown was confirmed via western blotting. pCAG-SpCas9-GFP-U6-gRNA was a gift from Jizhong Zou (Addgene plasmid #79144), KSR1 sgRNA and Control:Article Title: KSR1- and ERK-dependent Translational Regulation of the Epithelial-to-Mesenchymal Transition Article Snippet: .. The KSR1 knockdown was confirmed via Western Blotting. pCAG-SpCas9-GFP-U6-gRNA was a gift from Jizhong Zou (Addgene plasmid #79144), KSR1 sgRNA and Article Title: Tetracycline-dependent inhibition of mitoribosome protein elongation in mitochondrial disease mutant cells suppresses IRE1α to promote cell survival Article Snippet: HEK293T cells were then seeded in 6-well dishes (6×10 5 cells/well) and reverse transfected using Polyfect (Qiagen, 301105) following the manufacturers protocol. .. Transfection was carried out using 880 ng of lentiCRISPR-V2 with respective target-or Article Title: OVOL2 impairs RHO GTPase signaling to restrain mitosis and aggressiveness of Anaplastic Thyroid Cancer Article Snippet: .. For OVOL2 CRISPR-interference (CRISPRi) knockdown two sgRNAs (sg1: CACCGTCGCGAGTGAGACCACGCCG, sg2: CACCGTTGACACCGTTATGTTGCA) targeting the OVOL2 promoter and a Article Title: SETD2 safeguards the genome against isochromosome formation Article Snippet: .. HeLa TetOn-Cas9 cells were transduced with 8mg/mL polybrene (Millipore Sigma, TR-1003) and viral supernatant for guides targeting SETD2 or Article Title: KSR1- and ERK-dependent translational regulation of the epithelial-to-mesenchymal transition Article Snippet: .. The KSR1 knockdown was confirmed via western blotting. pCAG-SpCas9-GFP-U6-gRNA was a gift from Jizhong Zou (Addgene plasmid #79144), KSR1 sgRNA and Article Title: BAP1 deletion abrogates growth and metastasis of murine cutaneous melanoma Article Snippet: .. The sequence of Article Title: A stress-induced Tyrosine tRNA depletion response mediates codon-based translational repression and growth suppression Article Snippet: .. A Article Title: Suppression of mitochondrial ROS by prohibitin drives glioblastoma progression and therapeutic resistance Article Snippet: The truncated mutant forms of PRDX3 (1–221aa, 63–221aa, 63–256aa) were cloned into the pGEX-4T-1 vector (Adgene, #27-4580-01). .. Clones expressing two non-overlapping sgRNAs directed against human PHB or a Clone Assay:Article Title: KSR1- and ERK-dependent Translational Regulation of the Epithelial-to-Mesenchymal Transition Article Snippet: .. The KSR1 knockdown was confirmed via Western Blotting. pCAG-SpCas9-GFP-U6-gRNA was a gift from Jizhong Zou (Addgene plasmid #79144), KSR1 sgRNA and Article Title: OVOL2 impairs RHO GTPase signaling to restrain mitosis and aggressiveness of Anaplastic Thyroid Cancer Article Snippet: .. For OVOL2 CRISPR-interference (CRISPRi) knockdown two sgRNAs (sg1: CACCGTCGCGAGTGAGACCACGCCG, sg2: CACCGTTGACACCGTTATGTTGCA) targeting the OVOL2 promoter and a Article Title: KSR1- and ERK-dependent translational regulation of the epithelial-to-mesenchymal transition Article Snippet: .. The KSR1 knockdown was confirmed via western blotting. pCAG-SpCas9-GFP-U6-gRNA was a gift from Jizhong Zou (Addgene plasmid #79144), KSR1 sgRNA and Article Title: A stress-induced Tyrosine tRNA depletion response mediates codon-based translational repression and growth suppression Article Snippet: .. A Article Title: Suppression of mitochondrial ROS by prohibitin drives glioblastoma progression and therapeutic resistance Article Snippet: The truncated mutant forms of PRDX3 (1–221aa, 63–221aa, 63–256aa) were cloned into the pGEX-4T-1 vector (Adgene, #27-4580-01). .. Clones expressing two non-overlapping sgRNAs directed against human PHB or a Transfection:Article Title: Tetracycline-dependent inhibition of mitoribosome protein elongation in mitochondrial disease mutant cells suppresses IRE1α to promote cell survival Article Snippet: HEK293T cells were then seeded in 6-well dishes (6×10 5 cells/well) and reverse transfected using Polyfect (Qiagen, 301105) following the manufacturers protocol. .. Transfection was carried out using 880 ng of lentiCRISPR-V2 with respective target-or CRISPR:Article Title: OVOL2 impairs RHO GTPase signaling to restrain mitosis and aggressiveness of Anaplastic Thyroid Cancer Article Snippet: .. For OVOL2 CRISPR-interference (CRISPRi) knockdown two sgRNAs (sg1: CACCGTCGCGAGTGAGACCACGCCG, sg2: CACCGTTGACACCGTTATGTTGCA) targeting the OVOL2 promoter and a Transduction:Article Title: SETD2 safeguards the genome against isochromosome formation Article Snippet: .. HeLa TetOn-Cas9 cells were transduced with 8mg/mL polybrene (Millipore Sigma, TR-1003) and viral supernatant for guides targeting SETD2 or Sequencing:Article Title: BAP1 deletion abrogates growth and metastasis of murine cutaneous melanoma Article Snippet: .. The sequence of Article Title: A stress-induced Tyrosine tRNA depletion response mediates codon-based translational repression and growth suppression Article Snippet: .. A Generated:Article Title: A stress-induced Tyrosine tRNA depletion response mediates codon-based translational repression and growth suppression Article Snippet: .. A Expressing:Article Title: Suppression of mitochondrial ROS by prohibitin drives glioblastoma progression and therapeutic resistance Article Snippet: The truncated mutant forms of PRDX3 (1–221aa, 63–221aa, 63–256aa) were cloned into the pGEX-4T-1 vector (Adgene, #27-4580-01). .. Clones expressing two non-overlapping sgRNAs directed against human PHB or a |